vfam_trees is a bioinformatics pipeline for building maximum-likelihood phylogenetic trees for viral families. For each family it discovers species via NCBI Taxonomy, downloads sequences from GenBank, applies quality filtering, clusters per species, aligns with MAFFT, infers trees with FastTree and IQ-TREE, annotates internal nodes with LCA-based taxonomy, roots taxonomy-aware, and writes Newick, PhyloXML, and Auspice v2 (Nextstrain) JSON output along with PDF/PNG figures and per-run TSV summaries.
Two trees are produced per family:
- tree_500 — broad diversity tree (up to 500 sequences, FastTree / GTR+G or LG+G, SH-like support)
- tree_100 — collapsed representative tree (up to 100 sequences, IQ-TREE / GTR+G or
TEST-selected best-fit AA model; SH-aLRT support for nucleotide trees, UFBoot for protein trees)
The per-family pipeline runs in seven stages. Each stage is configurable per family (see Configuration); RefSeqs are protected at every step where sequences can be dropped.
The family TaxID is resolved from NCBI Taxonomy and every descendant species is enumerated. The species list defines the universe of organisms eligible for download. An optional manual.restrict_to_lineages list in the per-family config restricts this universe to one or more taxonomic lineages — each entry is a taxon at any rank (species, genus, subfamily, ...) given as a scientific name or a taxid; only species whose taxid is a descendant of at least one listed lineage proceed to download; others are skipped entirely.
GenBank is queried per species with RefSeq priority. The query targets the configured molecule (whole_genome or a marker name) and, for segmented viruses, the configured segment keyword (records lacking it in their title are dropped). When hmm.enabled, the marker-name query is instead replaced by a single all-proteins-per-species fetch, and markers are identified downstream by HMMER profile homology rather than by name (see HMM-based marker identification). RefSeqs are uncapped; non-RefSeq records are limited by download.max_per_species.
An optional shared cache (configurable TTL, per-entry locking, negative-result caching) avoids re-downloading the same species across runs and across parallel family jobs.
Each species' sequences are filtered in this order:
- Manual overrides (per-family
manual.include/manual.include_seq/manual.include_fasta_files/manual.exclude/manual.restrict_to_lineages) — accessions inmanual.excludeare dropped immediately; accessions inmanual.includebypass every QC step below and are protected from removal during clustering, proportional merge, and length-outlier filtering. Match is exact, version included (e.g.NC_002617.1).manual.include_seqaccepts pasted sequences (records not yet in GenBank) as a list of{id, organism, sequence}mappings;manual.include_fasta_filesaccepts paths to one or more FASTA files whose sequences are injected the same way. Both are injected after fetch, receive the same bypass + downstream protection asmanual.include, and their ids must not collide with any fetched accession (not supported in concat mode).manual.restrict_to_lineagesrestricts the set of species that proceed to download to those under one or more named taxonomic lineages (see Species discovery). - Organism exclusion — case-insensitive substring match against
ORGANISM,SOURCE, andDEFINITION(joined with newlines so terms cannot straddle field boundaries). Defaults:synthetic construct,metagenome,MAG:,uncultured,unverified,vector,recombinant,patent. - Ambiguity —
max_ambiguouscap on the fraction ofN/X/ IUPAC degenerate characters. - Minimum length —
min_length: nullauto-sets the threshold to 50% of the per-species median, with relaxation fallback to 40% then 30% if too few sequences pass; in all cases a hard floor of 200 bp / 100 aa applies. - Length-outlier filter (post-merge, pre-MSA) — two-sided keep window that is the union of (a) a MAD-on-log-lengths window and (b) a hard floor
[min_lo_mult, max_hi_mult] × median. See Length-outlier behaviour for the exact form. RefSeqs andmanual.includerecords flagged by the filter are kept with a warning.
- RefSeq absorption — non-RefSeq sequences ≥
refseq_absorption.threshold(default 0.99) identical to a RefSeq within the same species are absorbed into the RefSeq, suppressing redundant near-zero-branch cherries. RefSeqs themselves are never removed. - Adaptive per-species clustering — MMseqs2 with binary search for an identity threshold within
[clustering.threshold_min, threshold_max]that yields ≤max_reps_500(ormax_reps_100) representatives. - Proportional cross-species merge — when the species count exceeds the target tree size, species with at least one RefSeq are kept first; remaining slots fill by rep count. Species dropped at the cap (and how many of them carried a RefSeq) are recorded in
summary.tsvand a WARNING is logged.
- MAFFT with separate options for nucleotide vs. protein, and for tree_500 vs. tree_100 (the latter typically slower / more accurate).
- trimAl column trimming (
-automated1by default) between MAFFT and tree inference; pre-trim length, tool, and options are recorded per tree. - FastTree for tree_500 (configurable
model_nuc/model_aa;+G/+GAMMAenables discrete-gamma rate variation). - IQ-TREE for tree_100, with per-sequence-type options:
--fastfor nucleotides (SH-aLRT support, auto-added by the wrapper) and-B 1000for protein (UFBoot ultrafast bootstrap, more robust on divergent protein families). Settingmodel_aa: TESTtriggers ModelFinder; the chosen model (e.g.LG+I+G4) is parsed from the IQ-TREE log and surfaces insummary.tsv, the per-family PDF, and the PhyloXML provenance. - Branch-support measure is picked per tree (
SH_like/SH_aLRT/UFBoot) and recorded uniformly:tree{500,100}_support_typeplus genericsupport_{min,q1,median,q3,max,iqr}columns; the PhyloXML<confidence type="…">attribute mirrors the same label. - Iterative branch-length outlier removal — between iterations, leaves with terminal branch length exceeding
median + factor × MADare removed and MSA + tree are re-run (up tomax_iterations; only when ≥min_seqsremain). RefSeqs are protected: a flagged RefSeq stays with a warning. Detailed per-outlier log lines include length, ratio to median, and threshold. - Multi-marker protein concatenation — large DNA virus families with curated marker presets concatenate per-marker MAFFT + trimAl alignments into a single matrix; tree_100 uses partitioned IQ-TREE (
-p partitions.nex -m MFP) so each marker gets its own ModelFinder pick. Markers are found either by GenBank name (per-marker query) or, whenhmm.enabled, by HMMER profile homology over one all-proteins-per-species fetch (see HMM-based marker identification); either way the returned proteins are bucketed by source nucleotide accession (Policy A). A length filter (concatenation.source_nuc_min_length_frac, default 0.3) drops source-nuc accessions shorter than that fraction of the longest parent so partial single-gene submissions don't crowd out genome-scale proteins underdownload.max_per_species(default 3000 for concat families). See CONCAT_DESIGN.md for design details.
- LCA-based internal-node annotation using NCBI ranked lineages, with a configurable lineage-depth filter (
taxonomy.lca_min_rank, defaultspecies) so leaves whose lineage is too shallow are excluded from the LCA vote. - Genus inference for taxa lacking a formal
genusrank in NCBI lineage:none,suffix(single-word taxa ending invirustreated as genus, per ICTV convention), ordeepest(default — suffix first, then deepest rank above species). - Taxonomy-guided rooting via LCA specificity scoring, with MAD and midpoint fallbacks. The PhyloXML
<phylogeny>is emitted withrooted="true" rerootable="false"so downstream viewers cannot re-root the carefully rooted output. - Genus / subfamily coloring in HLS color space — one hue band per subfamily, lightness varies across genera within a subfamily; colors are applied to PDF/PNG figures and to PhyloXML (
style:font_color).
Per-family: Newick, PhyloXML (with <taxonomy>, <sequence>, vipr: metadata, and rank properties), an Auspice v2 (Nextstrain) JSON for interactive exploration, rooted-rectangular and unrooted-radial PDF + PNG tree images, a topology-only icon PNG, sequence and metadata FASTAs/TSVs, a per-family PDF report, and a per-family log.
Cross-family: a row-per-family summary.tsv with full statistics, a lightweight status.tsv (success/skip), and an overview_tree_100.png thumbnail grid shaded by viral realm. See Output for the full file inventory.
Per-family directories are named <Family>_<taxid> (e.g. Asfarviridae_137992) — or, when manual.name is set, <manual.name>_<taxid> (e.g. Orthoebolavirus_11266), with every output file prefixed by the same display name (see Output prefix and directory naming). Failures and skips at any stage produce a row in status.tsv with the skip reason; the per-family work directory is preserved for inspection.
- Interactive trees (Auspice / Nextstrain / Nextclade) — every family also emits a schema-valid Auspice v2 JSON per tree (
<prefix>_tree_{500,100}_auspice.json) loadable in the Nextstrain viewers: auspice.us (drag-and-drop), Nextclade, or a localauspice view. These are divergence trees (branch lengths are substitutions per site, not time-resolved); the "color by genus" view reuses the same palette as the PDF/PhyloXML output, and genus / subfamily / species / host / location / year (plus an Outbreak trait foradditional_data_sourcestips) are available as colorings and filters. Toggle with theoutput.auspice_jsonper-family flag (default on). - Custom output naming — set
manual.nameto rename a family's outputs (e.g. run Filoviridae restricted to the Orthoebolavirus genus and label everythingOrthoebolavirus); the directory and all files take the sanitized display name while NCBI/taxonomy/cache lookups keep using the biological family. See Output prefix and directory naming. - Additional data sources (outbreak sequences) — supplement a family tree with forced-include sequences from Pathoplexus via the
additional_data_sourcesconfig block. These bypass QC and clustering (likemanual.include) but carry real host/location/date/taxon metadata, so they are coloured by genus. Useful for grafting the latest outbreak genomes onto an existing tree. See Additional data sources (Pathoplexus). - HMM-based marker identification — for large DNA virus families with inconsistent annotation, identify marker proteins by HMMER profile homology instead of GenBank protein names, via the per-family
hmm:config block. Each marker carries anhmms:token — a single curated Pfam-A profile ("DNA_pol_B") or a multidomain architecture ("Adeno_hexon--Adeno_hexon_C", HMMs in N-to-C order). Hits are gated on the curated Pfam GA bit-score (or an E-value) plus HMM-model coverage; the all-proteins-per-species pool is grouped by source genome and assigned to markers by HMM. Works on both the single-marker and concatenated-marker paths. Bundled CC0 Pfam-A sets ship for Poxviridae (8 markers) and Adenoviridae (hexon); requires HMMER on$PATH. See HMM-based marker identification. - Pre-configured family presets — 28 segmented RNA virus families (segment keywords) and 26 DNA virus families (sequence type, region/marker, and concat marker sets for the 15 families that use concatenation) ship with curated defaults.
- Checkpointing — MSA and tree steps store a content-hashed sidecar of inputs + tool / model / options, so any change auto-invalidates the cache. Each iterative outlier-removal pass gets its own hash; partially-completed runs resume in the right place.
- Family-annotation TSV (optional) — joins extra per-family columns (e.g.
baltimore_class) intosummary.tsvandstatus.tsv. Missing file or family is silent. - Stage tracking —
vfam_trees statusreports the current processing stage for in-progress families (downloading/QC, MSA, tree inference, annotating). - Dry-run mode —
vfam_trees run --dry-runpreviews per-family parameters without executing. - Parallelism —
-j Nruns N families concurrently;-t Tsets threads per family job. The download cache and external tools are concurrency-safe. - Validation and warnings — partial NCBI batches, unrecognized per-family YAML keys, configs that override a recommended DNA-family setting, and MAFFT / tree output sanity checks all surface as log warnings.
biopython >= 1.81
click >= 8.1
pyyaml >= 6.0
matplotlib >= 3.9 # PDF report and tree images; requires NumPy 2.x compatible build
| Tool | Purpose |
|---|---|
mafft |
Multiple sequence alignment |
trimal |
Alignment column trimming |
FastTree |
Rapid ML tree inference (tree_500) |
iqtree2 |
ML tree inference (tree_100) |
mmseqs |
Sequence clustering |
hmmscan, hmmpress (HMMER) |
Optional — HMM-based marker identification (only when hmm.enabled) |
All required tools must be available on $PATH. Installation via conda is recommended:
conda install -c bioconda mafft fasttree iqtree mmseqs2 trimal
conda install -c bioconda hmmer # only needed for HMM-based marker identificationgit clone https://github.com/cmzmasek/vfam_trees.git
cd vfam_trees
pip install -e .# 1. Create and edit global config (sets NCBI email and API key)
vfam_trees init
# edit config/global.yaml
# 2. Check all dependencies
vfam_trees test
# 3. Generate per-family configs (review before running)
vfam_trees init-configs -f families.txt
# 4. Preview what will run without executing anything
vfam_trees run -f families.txt --dry-run
# 5. Run the pipeline
vfam_trees run -f families.txt -j 4 -t 4
# 6. Check progress
vfam_trees status -f families.txtGenerate a template with vfam_trees init. Then edit it to set your NCBI credentials:
ncbi:
email: your.email@example.com # REQUIRED
api_key: your_ncbi_api_key # optional but recommended (10 req/s vs 3 req/s)An NCBI API key can be obtained for free at https://www.ncbi.nlm.nih.gov/account/.
The defaults: section of global.yaml overrides the built-in defaults for all families. Per-family configs further override individual parameters.
cache:
dir: ~/.vfam_cache # shared across all runs on this machine (or a lab filesystem)
ttl_days: 90 # re-download after 90 days; null = never expireCache entries are keyed by (taxid, db, region, segment, max_per_species) so changing any query parameter triggers a fresh download. Parallel family jobs (-j N) coordinate via per-entry lock files. Negative results (species with zero hits) are cached too, so they are not re-queried on every run.
Management:
vfam_trees cache clear Asfarviridae
vfam_trees cache clear --all # wipe entire cache
vfam_trees cache stats # show entry count and sizeannotation_tsv: virus_families_annotation.tsvRelative paths are resolved against the global.yaml directory. The file must have a family column (case-insensitive match) plus any extra columns to be picked up — currently baltimore_class (Roman numeral I–VII per Baltimore 1971) is the only one read by the pipeline. Missing file, missing key, or missing family → column simply left empty.
family baltimore_class host_range segmented genome_size
Flaviviridae IV Vertebrates No ~11 kb
Poxviridae I Vertebrates No ~130–375 kbPer-family configs are auto-generated if missing. Generate them in advance to review and tune parameters before running:
vfam_trees init-configs -f families.txt
# Regenerate with current defaults (overwrites any manual edits):
vfam_trees init-configs -f families.txt --forceKey parameters:
download:
max_per_species: 300 # cap on non-RefSeq sequences per species
sequence:
type: nucleotide # nucleotide or protein
# auto-set to protein for large DNA virus families
region: whole_genome # whole_genome, or a marker name (e.g. "DNA polymerase", "hexon")
# auto-set for known large DNA virus families
segment: null # segment keyword for segmented viruses (e.g. "segment L")
# auto-set for known segmented RNA families
quality:
min_length: null # null = auto (50% of per-species median, floor 200 bp/100 aa)
max_ambiguous: 0.01 # maximum fraction of ambiguous bases/residues
exclude_organisms: # case-insensitive substring match against
- synthetic construct # ORGANISM + SOURCE + DEFINITION (joined with newline
- metagenome # so terms cannot straddle field boundaries)
- "MAG:" # metagenome-assembled genomes (NCBI DEFINITION prefix)
- uncultured
- unverified
- vector
- recombinant
- patent
clustering:
tool: mmseqs2
threshold_min: 0.70 # minimum clustering identity
threshold_max: 0.99 # maximum clustering identity
max_reps_500: 20 # max representatives per species for tree_500
max_reps_100: 5 # max representatives per species for tree_100
targets:
max_500: 500 # target sequences for tree_500
max_100: 100 # target sequences for tree_100
msa_500:
tool: mafft
options_nuc: "--6merpair --retree 2" # used for nucleotide sequences
options_aa: "--auto" # used for amino acid sequences (MAFFT auto-selects strategy)
msa_100:
tool: mafft
options_nuc: "--retree 3" # used for nucleotide sequences
options_aa: "--maxiterate 1000 --localpair" # used for amino acid sequences (MAFFT L-INS-i; high accuracy, slower)
msa_trim:
enabled: true # drop poorly-aligned columns before tree inference
tool: trimal
options: "-automated1" # adaptive; works for both nucleotide and protein
tree_500:
tool: fasttree
options_nuc: "" # used for nucleotide sequences
options_aa: "" # used for amino acid sequences (e.g. marker-gene families)
model_nuc: GTR+G
model_aa: LG+G # LG+G used for amino acid sequences
tree_100:
tool: iqtree
options_nuc: "--fast" # nucleotide: SH-aLRT support (auto-added by wrapper)
options_aa: "-B 1000" # protein: UFBoot ultrafast bootstrap (stronger support
# for divergent protein families; --fast is incompatible with -B)
model_nuc: GTR+G
model_aa: TEST # TEST = IQ-TREE ModelFinder; the chosen best-fit model
# is recorded in summary.tsv / PDF / PhyloXML instead of "TEST"
length_outlier:
enabled: true # pre-MSA length-based outlier removal
k: 5.0 # MAD-on-log keep window: exp(median(log L) ± k · σ_log)
# with σ_log = 1.4826 × MAD(log L); 0 disables MAD
min_lo_mult: 0.20 # never drop seqs ≥ this × median (0 disables lower floor)
max_hi_mult: 5.0 # never drop seqs ≤ this × median (0 disables upper floor)
outlier_removal:
enabled: true # iterative post-tree branch-length outlier removal
factor: 20.0 # threshold = median + factor × MAD (Median Absolute Deviation)
max_iterations: 3 # maximum MSA+tree iterations
min_seqs: 40 # only remove outliers when ≥ min_seqs sequences remain after removal
labeling:
format: "{species}|{id}|{host}" # format string for leaf labels (PhyloXML <name>,
# PDF/PNG tree images, FASTA display names).
# Placeholders: {species}, {id} (accession), {host},
# {strain}, {location}, {year}, {genus}.
# Literal text (separators etc.) is kept verbatim.
replace_whitespace: true # replace spaces in field values with underscores
keep_separator_on_empty: false # false: drop empty fields and their preceding
# separator so no leading/consecutive separators appear
# true: keep separators regardless of field content
coloring:
genus_inference: deepest # none: only formal NCBI genus-rank entries are colored
# suffix: single-word taxa ending in "virus" treated as genus
# (recovers ICTV genus names that NCBI still has at "no rank")
# deepest (default): suffix first, then deepest lineage entry
# above species rank
taxonomy:
lca_min_rank: species # none: every leaf contributes to internal-node LCA voting
# subfamily / genus / species (default): exclude leaves whose
# lineage does not reach this rank, so shallow lineages cannot
# drag ancestor labels back toward the root
output:
auspice_json: true # also emit an Auspice v2 (Nextstrain) JSON per tree
# (<prefix>_tree_{500,100}_auspice.json) for interactive
# viewing at auspice.us; divergence tree only (branch lengths
# are substitutions/site, so it is not time-resolved)
manual: # curator overrides on per-family record selection
include: [] # exact accessions (with version, e.g. "NC_002617.1") that
# bypass all QC (length, ambiguity, organism exclusion) and
# are protected through clustering, proportional merge, and
# length-outlier filtering — stronger than RefSeq at QC,
# equal to RefSeq downstream
include_seq: [] # pasted sequences not yet in GenBank — each entry is a
# {id, organism, sequence} mapping; injected after fetch,
# bypass QC, and receive the same downstream protection as
# manual.include records (not supported in concat mode)
include_fasta_files: [] # paths to FASTA files whose sequences are injected identically
# to include_seq entries; FASTA id field → sequence id,
# remainder of header → organism (not supported in concat mode)
exclude: [] # exact accessions to drop immediately after fetch, before QC
restrict_to_lineages: [] # restrict the pipeline to species under one or more named
# lineages — entries are taxon names at any rank (species,
# genus, subfamily, ...) or NCBI taxids (integer or digit
# string); only species descendant from at least one listed
# lineage proceed to download; empty or absent means use the
# full discovered species list
name: "" # override the display name in PDF/PNG titles and the PhyloXML
# <name> element; e.g. "Hantaviridae 2026". When set it ALSO
# becomes the output prefix: every output file and the output
# directory are renamed to a filesystem-safe form of it (the
# directory keeps its _<taxid> suffix). NCBI queries, taxonomy,
# caching, and the summary.tsv 'family' column still use the
# biological family. Empty (default) uses the family name.
# See "Output prefix and directory naming" below.
additional_data_sources: [] # supplement the tree with forced-include sequences from an
# external database (currently Pathoplexus). Each entry is a
# mapping; see "Additional data sources (Pathoplexus)" below.
# Bypass QC + clustering like manual.include; nucleotide-only;
# not supported in concat mode.The coloring, taxonomy, and output keys can also be set globally in the defaults: section of global.yaml — per-family configs inherit them automatically.
By default a family's outputs live in results/<Family>_<taxid>/ with every file prefixed <Family>_…. Setting manual.name overrides this prefix: the value is sanitized to a filesystem-safe form (runs of any character outside [A-Za-z0-9._-] collapse to _) and used for both the directory and every output file. The directory keeps its _<taxid> suffix for traceability.
For example, running Filoviridae restricted to the Orthoebolavirus genus with manual.name: Orthoebolavirus:
results/Orthoebolavirus_11266/
Orthoebolavirus_tree_100.nwk
Orthoebolavirus_tree_100.xml
Orthoebolavirus_tree_100_auspice.json
Orthoebolavirus_report.pdf
...
The biological family name is still used everywhere identity matters — NCBI species discovery and downloads, taxonomy resolution, the sequence cache, the summary.tsv / status.tsv family column, and vfam_trees status reporting. Each output directory carries a hidden .family marker recording the biological family, so status (and the other CLI subcommands) locate a renamed directory without re-reading config. If two families would resolve to the same directory (only possible when their manual.name values are identical and the NCBI taxid cannot be resolved), the run aborts with a clear error rather than overwriting the other family's outputs.
Families without manual.name are completely unaffected: the sanitized prefix equals the family name, so output paths are identical to earlier versions.
Example — adding a pasted reference and forcing a curator-picked accession in:
manual:
include:
- NC_002617.1 # force-keep this RefSeq even if QC would drop it
include_seq:
- id: MyLab_Isolate_2026
organism: Foo virus
sequence: |
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
- id: PreprintSeq_42
organism: Bar virus
sequence: ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
include_fasta_files:
- /data/unpublished/batch_2026_isolates.fasta
- /data/unpublished/outgroup.fa
exclude:
- KF234567.1 # drop a known-bad isolate before QCNotes on include_seq and include_fasta_files:
id(forinclude_seq) or the first whitespace-delimited token of the FASTA header (forinclude_fasta_files) is used throughout the pipeline (FASTA headers, tree leaves, PhyloXML) and must not collide with any accession returned by NCBI for the family, with anything ininclude/exclude, or across the two options — collisions raise a hard error.organism(forinclude_seq) or the remainder of the FASTA header after the id (forinclude_fasta_files) controls the species bucket the entry joins (matching a fetched species name appends to that bucket; a novel name creates a new one) and shows up in leaf labels. If a FASTA header is a single token (no remainder), the organism is left empty and the leaf label is just the header itself.- For
include_seq, the sequence may be wrapped across lines — whitespace is stripped and the sequence is uppercased. - Injected leaves render gray (no genus) and do not participate in LCA voting, since only id and organism are required.
- Not supported when
sequence.region == "concatenated"— injected sequences cannot be split into per-marker proteins.
additional_data_sources pulls forced-include sequences from an external pathogen database and injects them into the tree exactly like manual.include records — they bypass QC and clustering/subsampling and are protected from length-/branch-outlier removal. The typical use is adding the latest outbreak genomes to an existing family tree. Unlike pasted sequences, these carry real host / location / collection-date / taxon metadata, so they are labelled and coloured by genus like fetched records.
Currently the only source is Pathoplexus (pathoplexus.org), queried through its GenSpectrum LAPIS API. Pathoplexus organises data into a fixed set of curated organisms addressed by slug (not by taxid), so a genus-level tree lists one entry per organism — e.g. the Orthoebolavirus genus spans ebola-zaire, ebola-sudan, and ebola-bdbv:
additional_data_sources:
- source: pathoplexus
organism: ebola-zaire # Pathoplexus organism slug (required)
country: Uganda # optional, exact (LAPIS geoLocCountry)
host: Homo sapiens # optional, exact (LAPIS hostNameScientific)
date_from: "2022-01-01" # optional ISO date (collection-date lower bound)
date_to: "2022-12-31" # optional ISO date (collection-date upper bound)
max_seqs: 200 # optional cap (default 200) — these skip subsampling
dedup_vs_ncbi: true # optional (default true) — drop records already pulled
# from NCBI (matched by INSDC accession)
name_prefix: "PATHOPLEXUS_" # optional — prepended verbatim to each leaf label
outbreak_name: "Bdbv-2026" # optional — tags tips (vipr:outbreak + Auspice trait)
- source: pathoplexus
organism: ebola-sudanValid organism slugs: andv, cchf, dengue, ebola-bdbv, ebola-sudan, ebola-zaire, hmpv, marburg, measles, mpox, rsv-a, rsv-b, west-nile, yellow-fever.
Notes:
- Nucleotide-only, and the family's tree must be nucleotide (e.g.
sequence.region: whole_genome). Not supported whensequence.region == "concatenated". name_prefixis prepended verbatim to every leaf label from that source (supply your own trailing separator, e.g.PATHOPLEXUS_), so external tips are easy to spot in the tree, FASTA,*_id_map.tsv, PhyloXML, and Auspice.outbreak_nametags each injected tip with the given label, emitted as a PhyloXMLvipr:outbreakproperty and an Outbreak colouring + filter in the Auspice JSON — handy for isolating the outbreak clade in Nextstrain. Both fields appear only when set, so ordinary trees are unaffected.- Only the latest version of each Pathoplexus accession is fetched; revoked records are excluded.
- The Pathoplexus accession (e.g.
PP_000PHDC.3) is used as the sequence id and must not collide with a fetched NCBI accession. - The fetch happens at pipeline runtime; the config is validated at load (known source, valid organism slug, ISO dates, positive
max_seqs). A network failure aborts that family with a clear error rather than silently dropping the requested sequences.
Example — restricting a family run to specific lineages (mixing ranks, names, and taxids):
manual:
restrict_to_lineages:
- Orthohantavirus # genus — all species under it are kept
- Mobatvirus # another genus in the same family
- Hantaan orthohantavirus # individual species also accepted
- 11595 # NCBI taxid (integer) — equivalent to the species name above
- "1980519" # taxid as a quoted digit string — also acceptedFor each entry, NCBI Taxonomy is queried for the species-rank descendants under that taxon; the family's discovered species list is then restricted to those that fall under at least one of the listed lineages. Entries whose subtree does not overlap the discovered species produce a WARNING in the log (typo, or a taxon outside this family). If restrict_to_lineages matches nothing in the discovered species list the family is skipped with an explanatory status entry.
Just before alignment, vfam_trees removes sequences whose length is wildly out of line with the rest of the family — tiny fragments and unusually long records (often mis-annotated or concatenated entries). A handful of these distort the whole multiple-sequence alignment far out of proportion to their number, so they are dropped first. (RefSeq and manual.include records are never dropped here; if flagged they are kept with a warning.)
The filter keeps a window of acceptable lengths and removes anything outside it. The window is designed to be generous by default but adaptive when the data call for it. It is the wider of two ranges on each side:
- A fixed safety range — by default
0.20× to 5×the median length. Anything in this range is always kept; this is what stops the filter from over-trimming. - An adaptive range — from how spread out the family's lengths actually are (a robust, outlier-resistant estimate on log-lengths). When a family genuinely spans a broad range of lengths, this widens the window so real long/short members survive. It can only widen the window, never shrink it below the fixed range.
A sequence is removed only if it falls outside both — that is, only genuine extremes are cut.
Why combine them? If you used only the adaptive range, a very uniform family (almost every sequence the same length) would have a near-zero spread, collapsing the window to a sliver and wrongly flagging anything slightly off. The fixed floor prevents that. If you used only the fixed range, a genuinely diverse family would lose real members; the adaptive range widens it when warranted. Combining them gives both.
Exact form. Keep a sequence of length L when lo ≤ L ≤ hi:
lo = min( 0.20 × median , exp( median(log L) − k·σ ) ) # k = 5 by default
hi = max( 5.0 × median , exp( median(log L) + k·σ ) )
└─── fixed floor ───┘ └──── adaptive (robust, on log-lengths) ────┘
σ = 1.4826 × MAD(log L) # a robust stand-in for the std. dev. of log-lengths
Per-family knobs: length_outlier.k (default 5; set 0 to disable the adaptive range), min_lo_mult / max_hi_mult (default 0.20 / 5.0 — set either to 0 to disable that side of the floor).
Worked examples (median length = 1000, defaults k=5, floor 0.20×–5×):
| Family's length distribution | Keep window | What happens |
|---|---|---|
| Very uniform (all ≈ 1000) | 200 – 5000 |
Adaptive range ~vanishes; the floor governs. A 400-nt record (0.40×) is kept |
| Broadly spread (~2× range) | ≈190 – ≈5230 |
Adaptive range widens past the floor to admit the family's real long/short members |
| Half the sequences tied at the median | 200 – 5000 |
Robust spread = 0, so the floor alone applies |
| Uniform bulk + one 30,000-nt record (30×) | 200 – 5000 |
30,000 is outside the window → dropped |
| Uniform bulk + one 30-nt fragment (0.03×) | 200 – 5000 |
30 is outside the window → dropped |
The outcome — how many long and short outliers were dropped, the median, and the resolved lo/hi — is logged once per tree and written to summary.tsv (tree{500,100}_n_length_outliers_{long,short}, length_filter_median, length_filter_lo_cutoff, length_filter_hi_cutoff).
Known DNA virus families are automatically configured with curated ICTV-aligned markers. Small ssDNA / dsDNA families use a single diagnostic protein (when one is well established), medium–large dsDNA families use a family-specific structural or replication protein, and nucleocytoplasmic large DNA viruses (NCLDVs) share DNA polymerase (family B) as a universal marker:
| Family group | Marker gene | Sequence type |
|---|---|---|
| Circoviridae, Smacoviridae | Rep | protein |
| Anelloviridae | ORF1 | protein |
| Parvoviridae | NS1 | protein |
| Polyomaviridae | large T antigen | protein |
| Papillomaviridae | L1 | protein |
| Hepadnaviridae | whole genome | nucleotide |
| Adenoviridae | hexon | protein |
| Orthoherpesviridae, Alloherpesviridae, Herpesviridae | DNA polymerase | protein |
| Malacoherpesviridae | major capsid protein | protein |
| Iridoviridae | major capsid protein | protein |
| Asfarviridae | B646L (p72) | protein |
| Baculoviridae, Nudiviridae | lef-8 | protein |
| Ascoviridae | DNA polymerase | protein |
| Poxviridae | rpo147 | protein |
| Nimaviridae, Hytrosaviridae, Phycodnaviridae, Mimiviridae, Marseilleviridae, Pandoraviridae, Pithoviridae, Medusaviridae | DNA polymerase | protein |
Families using multi-marker protein concatenation (region: concatenated) are documented in CONCAT_DESIGN.md; when a family appears there, the concat preset takes precedence over the single-marker fallback in the table above. The presets were re-tuned against actual NCBI annotation coverage in the 2026-05 cache audit (v1.2.30 also added [Title] to the protein fetch query — [Protein Name] is sparsely populated for several viral families, so the actual product name had to be matched against the FASTA defline instead):
- Ascoviridae — split off from the 7-gene baculovirus core (LEF / PIF genes 0 % coverage in Ascoviridae) to its own 3-marker preset (DNA polymerase, major capsid protein, DNA helicase P143).
- Iridoviridae — trimmed from 7 to 6 markers (VLTF-3 dropped — genuinely absent from NCBI Iridoviridae annotations even after the
[Title]query fix in v1.2.30). - Poxviridae — trimmed from 9 to 8 markers (single-stranded DNA-binding protein / I3L at 1 %).
- Alloherpesviridae — split off from the Orthoherpesviridae 7-gene set to a 6-marker subset (ssDNA-binding / ICP8 at 0 % in fish herpesviruses).
- Malacoherpesviridae — removed from concatenation entirely (5 species, only MCP and DNA pol annotated); falls back to single-marker MCP.
- Phycodnaviridae — split off from the 8-marker NCLDV hallmark fallback to a custom 4-marker preset (DNA polymerase, major capsid protein, packaging ATPase, mRNA capping enzyme); the other four hallmarks remain at 0–1 % coverage even with the
[Title]query fix. - Mimiviridae, Marseilleviridae, Pithoviridae — split off from the NCLDV fallback to 6-marker presets (per-family drop list).
The 8-marker NCLDV-hallmark fallback now applies only to Pandoraviridae and Medusaviridae (no cache audit data yet). If a stale auto-generated config file exists with incorrect settings for any of these families, the program logs a warning and suggests deleting the file to regenerate it.
For large DNA virus families whose GenBank annotation is inconsistent (synonyms, gene-symbol vs descriptive names, mis-/un-annotated or divergent orthologs), marker proteins can be identified by HMMER profile homology instead of protein-name queries. Enable it per family with the hmm: block and give each marker an hmms: token list:
hmm:
enabled: true
database: Poxviridae # bundled set name, a dir of .hmm files, or a single .hmm path
default_evalue: 1.0e-5 # used only for profiles lacking a curated Pfam GA
use_ga_when_available: true # prefer each profile's curated GA bit-score
relative_length_cutoff: 0.5 # min fraction of the HMM model a hit must cover
multidomain_overlap_tolerance: 30 # residue slack between adjacent domains of an "A--B" token
threads: null # hmmscan --cpu; null → the run's thread count
# Single-marker family (DNA_FAMILIES) — token on the sequence block.
# OR'd tokens: try the 2-domain architecture first, fall back to the single domain.
sequence:
region: hexon
type: protein
hmms: ["Adeno_hexon--Adeno_hexon_C", "Adeno_hexon"]
# Concatenation family — token per marker:
concatenation:
proteins:
- {name: "DNA polymerase", hmms: ["DNA_pol_B"], locus_tag_hint: "E9L|polB"}
# ...Tokens. A token is either a single profile NAME ("DNA_pol_B") or a multidomain architecture "A--B--C" whose HMMs must hit in N-to-C order along the protein (non-overlapping, within multidomain_overlap_tolerance). Multiple tokens on one marker are alternatives (OR'd) — useful when a protein has divergent architectures. A marker that declares hmms is HMM-authoritative (no name fallback); markers without hmms fall back to name+alias matching, so mixed sets work.
How it works. When hmm.enabled, the per-marker name queries are replaced by an all-proteins-per-species fetch. Each protein is scanned once (hmmscan, batched and sequence-deduplicated); a hit passes when it clears the curated Pfam GA bit-score (or default_evalue) and covers ≥ relative_length_cutoff of the HMM model. Proteins are grouped by source genome and the longest token-satisfying protein is chosen per marker; max_per_species then bounds the number of genomes kept (RefSeq-first). Works on both the single-marker and concatenated-marker paths; the global sequence cache is bypassed in HMM mode.
Bundled profiles. Curated CC0 Pfam-A sets ship under vfam_trees/data/hmms/<Family>/ and are selected by bare family name (database: Poxviridae). Poxviridae (8 single-domain markers) and Adenoviridae (hexon, as the 2-domain Adeno_hexon--Adeno_hexon_C architecture OR'd with the single Adeno_hexon domain) are bundled and enabled in their presets. (A live 761-species Adenoviridae run showed the strict 2-domain gate is highly specific but under-sensitive — Adeno_hexon_C misses its GA cutoff on divergent hexons and partial deposits split the domains across records — hence the single-domain fallback. Likewise a live Poxviridae run showed the generic capping-enzyme Pfam families don't match the poxvirus D1 large subunit at all, so that marker uses the N7-methyltransferase domain mRNA_G-N7_MeTrfase with a per-family relative_length_cutoff of 0.40 — empirical validation per family matters.) Point database at your own directory of .hmm files (or a single .hmm) for other families; the set is auto-combined and hmmpress-ed on first use. Rebuild the bundled sets with scripts/build_bundled_hmms.sh. Requires HMMER (hmmscan/hmmpress) on $PATH.
# Generate global config template
vfam_trees init
# Overwrite an existing global config
vfam_trees init --force
# Check all dependencies and NCBI connectivity
vfam_trees test
# Generate per-family configs without running
vfam_trees init-configs -f families.txt
# Regenerate configs with current defaults (overwrites manual edits)
vfam_trees init-configs -f families.txt --force
# Preview per-family parameters without running the pipeline
vfam_trees run -f families.txt --dry-run
# Run pipeline (1 family at a time)
vfam_trees run -f families.txt
# Run with 4 parallel families, 4 threads each
vfam_trees run -f families.txt -j 4 -t 4
# Force re-run families already marked as done
vfam_trees run -f families.txt --force
# Check progress (shows current stage for in-progress families)
vfam_trees status -f families.txt
# (Re-)generate the overview PNG of all tree_100 trees
vfam_trees overview
# Cache management
vfam_trees cache clear Asfarviridae
vfam_trees cache clear --all --yes
vfam_trees cache statsThe families.txt file should contain one ICTV family name per line. Lines beginning with # are treated as comments and ignored:
# Positive-sense RNA viruses
Flaviviridae
Coronaviridae
# Negative-sense RNA viruses
Filoviridae
When
manual.nameis set,<Family>in the directory name and in every filename below is replaced by the sanitized display name (the directory still keeps its_<taxid>suffix). See Output prefix and directory naming.
Trees
| File | Description |
|---|---|
<Family>_tree_{500,100}.nwk |
Newick tree |
<Family>_tree_{500,100}.xml |
PhyloXML tree (rooted, non-rerootable; <taxonomy>, <sequence>, vipr: metadata, rank properties, style:font_color) |
<Family>_tree_{500,100}_auspice.json |
Auspice v2 (Nextstrain) JSON — interactive divergence tree, schema-valid for auspice.us / Nextclade / auspice view; genus / subfamily / species / host / location / year (and Outbreak for additional_data_sources tips) colorings and filters, genus palette matching the other outputs, branch support as toggleable branch labels. Emitted unless output.auspice_json: false |
Tree images — each tree is exported in two layouts at PDF and 150 dpi PNG:
| File | Layout |
|---|---|
<Family>_tree_{500,100}.{pdf,png} |
Rooted rectangular: taxonomy-annotated internal labels (genus / subgenus / subfamily / family); support values < 50% suppressed; genus/subfamily color legend; two-line figure caption (method · alignment · stats) |
<Family>_tree_{500,100}_ur.{pdf,png} |
Unrooted radial: equal-angle layout with leaf labels rotated outward; no internal labels, no support values; same coloring as rooted |
<Family>_tree_icon.png |
Square topology-only thumbnail of tree_100 (no labels, uniform branch color; size and colors configurable) |
Sequences and metadata
| File | Description |
|---|---|
<Family>_sequences_raw_{500,100}.fasta |
Sequences entering the MSA (post-QC, post-clustering, post-merge, post-length-outlier-filter; before post-tree branch-length outlier removal) |
<Family>_alignment_{500,100}.fasta |
Final alignment fed to the tree (MAFFT + trimAl when msa_trim.enabled: true; reflects sequences after iterative branch-length outlier removal) |
<Family>_metadata_{500,100}.tsv |
Per-leaf metadata |
<Family>_id_map.tsv |
Short ID → display name mapping (single-protein / whole-genome runs) |
Concat-mode only (large DNA virus families; see CONCAT_DESIGN.md)
| File | Description |
|---|---|
<Family>_id_map_{500,100}.tsv |
Per-tree id-map (concat keeps source-nuc accessions as leaf IDs) |
<Family>_partitions_{500,100}.nex |
NEXUS charset coordinates of each marker block in the concatenated alignment |
<Family>_markers_{500,100}/ |
Per-marker FASTAs: <safe_marker>_raw.fasta (unaligned) and <safe_marker>_alignment.fasta (post-trim when enabled) |
Reports and logs
| File | Description |
|---|---|
<Family>_report.pdf |
Stats table (taxid, lineage, molecule/region, species/QC counts, sequence-length stats, per-tree MSA / tree / clustering / support stats), post-QC and per-tree length histograms, support histograms, tree_100 visualization with color legend |
<Family>.log |
Per-family log |
| File | Description |
|---|---|
summary.tsv |
One row per family analyzed (success or skip): species counts, QC breakdown, sequence-length stats, clustering thresholds, MSA / trim / tree program-model-options, leaf counts, support stats, length- and branch-outlier counts and cutoffs, genus/subfamily counts, plus joined columns from annotation_tsv (e.g. baltimore_class) |
status.tsv |
Lightweight one-row-per-family table: family, ncbi_taxid, molecule_region, status (OK or skip reason), lineage, baltimore_class |
overview_tree_100.png |
Thumbnail grid of all tree_100 trees, shaded by viral realm (ssDNA, dsDNA, –ssRNA, +ssRNA/dsRNA, RT viruses) |
GNU General Public License v3.0 (GPLv3). See LICENSE for details.